Length polymorphisms in mtDNA of each individual.

Numbers refer to the nucleotide numbers of the revised Cambridge reference sequence (rCRS). 
Individual Hypervariable region 1
(303-317)
CA repeat
(514-523)

C stretch 1
(568-573)

12S rRNA
(956-965)

C stretch 2
(5895-5899)

9-bp deletion/insertion
(8272-8289)

Hypervariable region 2
(16180-16195)

rCRS CCCCCCCTCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA
Kong5133 CCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA ACCCCCCCCCCCCAT
Kong5134 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5135 CCCCCCCCCTCCCCCCAC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AAACCCCCCCCCCCAT
Kong5136 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AACCCCCCCCCCCCAT
Kong5137 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5138 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5139 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5140 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AAACCCCCCCCCCCAT
Kong5141 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5142 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5143 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5144 CCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5145 CCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AAACCCCCCCCCCCAT
Kong5146 CCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5147 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCCCCCCTACCCCCTCTA AACCCCCCCCCCCCAT
Kong5148 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5149 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AACCCCCCCCCCCAT
Kong5150 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTACCCCCTCTA AAAATCCCCCCCCCAT
Kong5151 CCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAACCCCCCCCCCCAT
Kong5152 CCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCTCAT
Kong5153 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5154 CCCCCCCTCCCCCCGC CACACACACA CCCCCCCCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5155 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACTCCCCCCCCAT
Kong5156 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5157 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCCCCCCAT
Kong5158 CCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5159 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5160 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5161 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAATCCCCTCCCCAT
Kong5162 CCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AACCCCCCCCCCCCAT
Kong5163 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCCCCCCCTACCCCCTCTA AACCCCCCCCCCCCAT
Kong5164 CCCCCCCCCTCCCCCCGC CACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA GAAACCCCCCCCCCAT
Kong5165 CCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AAAACCCCCTCCCCAT
Kong5166 CCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5167 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5168 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5169 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCCCCCCAT
Kong5170 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCCC CCCCCTCTA AAACCCCCCCCCCCAT
Kong5171 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCTCAT
Kong5172 CCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5173 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAACCCCCCCCCCCAT
Kong5174 CCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5175 CCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5176 CCCCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5177 CCCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5178 CCCCCCCCCTCCCCCCGC CACACACA CCCCCCCCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT
Kong5179 CCCCCCCCTCCCCCCGC CACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTA AACCCCCCCCCCCCAT
Kong5180 CCCCCCCTCCCCCCGC CACACACACA CCCCCC CCCCCTCCCC CCCCC CCCCCTCTACCCCCTCTA AAAACCCCCTCCCCAT

@