Length polymorphisms in mtDNA of each individual.

Numbers refer to the nucleotide numbers of the revised Cambridge reference sequence (rCRS). 
Individual Hypervariable region 1
(303-317)
CA repeat
(514-523)

C stretch 1
(568-573)

12S rRNA
(956-965)

C stretch 2
(5895-5899)

9-bp deletion/insertion
(8272-8289)

Hypervariable region 2
(16180-16195)

rCRS
CCCCCCCTCCCCCGC
CACACACACA
CCCCCC
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
AAAACCCCCTCCCCAT
MKsq0001
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0002
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0003
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0004
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0005
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0006
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0007
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0008
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0009
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0010
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0011
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0012
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0013
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0014
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0015
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0016
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0017
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0018
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0019
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0020
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0021
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0022
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0023
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0024
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0025
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0026
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0027
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0028
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0029
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0030
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0031
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0032
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0033
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0034
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0035
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0036
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0037
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0038
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0039
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0040
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0041
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0042
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0043
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0044
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0045
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0046
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0047
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0048
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0049
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0050
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0051
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0052
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0053
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0054
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0055
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0056
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0057
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0058
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0059
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0060
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0061
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0062
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0063
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0064
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0065
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0066
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0067
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0068
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0069
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0070
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0071
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0072
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0073
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0074
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0075
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0076
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0077
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0078
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0079
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0080
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0081
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0082
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0083
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0084
-
-
-
CCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0085
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0086
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0087
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0088
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0089
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0090
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0091
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0092
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0093
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0094
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0095
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0096
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0097
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0098
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0099
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0100
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0101
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0102
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0103
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0104
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0105
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0106
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0107
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0108
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0109
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0110
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0111
-
-
-
CCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0112
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0113
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0114
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0115
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0116
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0117
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0118
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0119
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0120
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0121
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0122
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0123
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0124
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0125
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0126
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0127
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0128
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0129
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0130
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0131
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0132
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0133
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0134
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0135
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0136
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0137
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0138
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0139
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0140
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0141
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0142
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0143
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0144
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0145
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0146
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0147
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0148
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0149
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0150
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0151
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0152
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0153
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0154
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0155
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0156
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0157
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0158
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0159
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0160
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0161
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0162
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0163
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0164
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0165
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0166
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0167
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0168
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0169
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0170
-
-
-
CCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0171
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0172
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0173
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0174
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0175
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0176
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0177
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0178
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0179
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0180
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0181
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0182
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0183
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0184
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0185
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0186
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0187
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0188
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0189
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0190
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0191
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0192
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0193
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0194
-
-
-
CCCCCTCCCC
CCCCC
TCCCCCCTCCCACCCCCTTTA
-
MKsq0195
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0196
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0197
-
-
-
CCCCCTCCCC
CCCC
CCCCCTCTA
-
MKsq0198
-
-
-
CCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0199
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0200
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0201
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0202
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0203
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0204
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0205
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0206
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0207
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0208
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0209
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0210
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0211
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0212
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0213
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0214
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0215
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0216
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0217
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0218
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0219
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0220
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0221
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0222
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0223
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0224
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0225
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0226
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0227
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0228
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0229
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0230
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0231
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0232
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0233
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0234
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0235
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0236
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0237
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0238
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0239
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0240
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0241
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0242
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0243
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0244
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0245
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0246
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0247
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0248
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0249
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0250
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0251
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0252
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0253
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0254
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0255
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0256
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0257
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0258
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0259
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0260
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0261
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0262
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0263
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0264
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0265
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0266
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0267
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0268
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0269
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0270
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0271
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0272
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0273
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0274
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0275
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0276
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0277
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0278
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0279
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0280
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0281
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0282
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0283
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0284
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0285
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0286
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0287
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0288
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0289
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0290
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0291
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0292
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0293
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0294
-
-
-
CCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0295
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0296
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0297
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0298
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0299
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0300
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0301
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0302
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0303
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0304
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0305
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0306
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0307
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0308
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0309
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0310
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0311
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0312
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0313
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0314
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0315
-
-
-
CCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0316
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0317
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0318
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0319
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0320
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0321
-
-
-
CCCCCGCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0322
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0323
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0324
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0325
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0326
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0327
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0328
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0329
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0330
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0331
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0332
-
-
-
CCCCCCCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0333
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0334
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0335
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0336
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0337
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0338
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0339
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0340
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0341
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0342
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0343
-
-
-
CCCCCGCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0344
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0345
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0346
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0347
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0348
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0349
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0350
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0351
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0352
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0353
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0354
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0355
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0356
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0357
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0358
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0359
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0360
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0361
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0362
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0363
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0364
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0365
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0366
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0367
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0368
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0369
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0370
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0371
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0372
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0373
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0374
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0375
-
-
-
CCCCCTCCCC
CCCCC
CCCCACTCTA
-
MKsq0376
-
-
-
CCCCCCCCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0377
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0378
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0379
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0380
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0381
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0382
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0383
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0384
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0385
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0386
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0387
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0388
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0389
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0390
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0391
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0392
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0393
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0394
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0395
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0396
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0397
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0398
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0399
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0400
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0401
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0402
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0403
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0404
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0405
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0406
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0407
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0408
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0409
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0410
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0411
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0412
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0413
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0414
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0415
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0416
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0417
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0418
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0419
-
-
-
CCCCCTCCCC
CCCCC
CCCCCCTCTA
-
MKsq0420
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0421
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0422
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0423
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0424
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0425
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0426
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0427
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0428
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0429
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0430
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0431
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0432
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0433
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0434
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0435
-
-
-
CCCCCTCCCC
CCCCC
CCCCCCCCTCTA
-
MKsq0436
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0437
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0438
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0439
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0440
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0441
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0442
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0443
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0444
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0445
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0446
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0447
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTA
-
MKsq0448
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0449
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0450
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0451
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0452
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0453
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0454
-
-
-
CCCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0455
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0456
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0457
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0458
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0459
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0460
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0461
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0462
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0463
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0464
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0465
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0466
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0467
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0468
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0469
-
-
-
CCCCCCCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0470
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0471
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0472
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0473
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0474
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0475
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0476
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0477
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0478
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0479
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0480
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0481
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0482
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0483
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0484
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0485
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0486
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0487
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0488
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0489
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0490
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0491
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0492
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0493
-
-
-
CCCCCGCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0494
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0495
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0496
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0497
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0498
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0499
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0500
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0501
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0502
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0503
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0504
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0505
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0506
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0507
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0508
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0509
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0510
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0511
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0512
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0513
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0514
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0515
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0516
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0517
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0518
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0519
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0520
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0521
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0522
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0523
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0524
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0525
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0526
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0527
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0528
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0529
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0530
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0531
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0532
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0533
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0534
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0535
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTGCCCCCTCTA
-
MKsq0536
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0537
-
-
-
CCCCCTCCCC
CCCCC
CCCCTCCTCTA
-
MKsq0538
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0539
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0540
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0541
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0542
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0543
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0544
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0545
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0546
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0547
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0548
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0549
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0550
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0551
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0552
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0553
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0554
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0555
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0556
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0557
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0558
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0559
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-
MKsq0560
-
-
-
CCCCCTCCCC
CCCCC
CCCCCTCTACCCCCTCTA
-