TECHNICAL ANNEX

Table 6. H primers for sequence reaction or amplification of heavy-strand of mitochondrial DNA@

Segment Primer Position Sequence (5'-3')
From to
02R H807 807 826 TAATCACTGCTGTTTCCCGT
21R H6158 6158 6177 TATCGGGGGCACCGATTATT
58R H81 81 100 CAGCGTCTCGCAATGCTATC
60R H528 528 547 TTCGGGGTATGGGGTTAGCA