TECHNICAL ANNEX

Table 5. FL primers for amplification of light-strand of mitochondrial DNA

Primer Name Position Sequence (5'-3')
From to
FL100 100 119 TGTAAAACGACGGCCAGTGGAGCCGGAGCACCCTATGT
FL398 398 417 TGTAAAACGACGGCCAGTTTTTATCTTTTGGCGGTATG
FL700 700 719 TGTAAAACGACGGCCAGTAGCATCCCCGTTCCAGTGAG
FL995 995 1014 TGTAAAACGACGGCCAGTAAAACTCCAGTTGACACAAA
FL1254 1254 1273 TGTAAAACGACGGCCAGTCTATATACCGCCATCTTCAG
FL1485 1485 1504 TGTAAAACGACGGCCAGTGCCCGTCACCCTCCTCAAGT
FL1779 1779 1798 TGTAAAACGACGGCCAGTATAGTACCGCAAGGGAAAGA
FL2045 2045 2064 TGTAAAACGACGGCCAGTACTTTAAATTTGCCCACAGA
FL2332 2332 2351 TGTAAAACGACGGCCAGTCGCATAAGCCTGCGTCAGAT
FL2616 2616 2635 TGTAAAACGACGGCCAGTAATAGGGACCTGTATGAATG
FL2864 2864 2883 TGTAAAACGACGGCCAGTTCACCAGTCAAAGCGAACTA
FL3119 3119 3138 TGTAAAACGACGGCCAGTCCCTGTACGAAAGGACAAGA
FL3455 3455 3474 TGTAAAACGACGGCCAGTCTGACGCCATAAAACTCTTC
FL3712 3712 3731 TGTAAAACGACGGCCAGTGTAGCCCAAACAATCTCATA
FL4008 4008 4027 TGTAAAACGACGGCCAGTAAACACCCTCACCACTACAA
FL4250 4250 4269 TGTAAAACGACGGCCAGTCCCCTCAAACCTAAGAAATA
FL4529 4529 4548 TGTAAAACGACGGCCAGTAGCGCTAAGCTCGCACTGAT
FL4827 4827 4846 TGTAAAACGACGGCCAGTCAAGGCACCCCTCTGACATC
FL5110 5110 5129 TGTAAAACGACGGCCAGTCCGCATTCCTACTACTCAAC
FL5362 5362 5381 TGTAAAACGACGGCCAGTACTCCACCTCAATCACACTA
FL5602 5602 5621 TGTAAAACGACGGCCAGTCCCACTCTGCATCAACTGAA
FL5890 5890 5909 TGTAAAACGACGGCCAGTCCTCACCCCCACTGATGTTC
FL6186 6186 6205 TGTAAAACGACGGCCAGTCCCCGCATAAACAACATAAG
FL6452 6452 6471 TGTAAAACGACGGCCAGTCTTCGTCTGATCCGTCCTAA
FL6716 6716 6735 TGTAAAACGACGGCCAGTAGGTATGGTCTGAGCTATGA
FL6957 6957 6976 TGTAAAACGACGGCCAGTGGCCTGACTGGCATTGTATT
FL7245 7245 7264 TGTAAAACGACGGCCAGTACCACATGAAACATCCTATC
FL7497 7497 7516 TGTAAAACGACGGCCAGTGGCCTCCATGACTTTTTCAA
FL7762 7762 7781 TGTAAAACGACGGCCAGTGGAAATAGAAACCGTCTGAA
FL8053 8053 8072 TGTAAAACGACGGCCAGTACAAGACGTCTTGCACTCAT
FL8345 8345 8364 TGTAAAACGACGGCCAGTCCAACACCTCTTTACAGTGA
FL8635 8635 8654 TGTAAAACGACGGCCAGTCTCATCAACAACCGACTAAT
FL8913 8913 8932 TGTAAAACGACGGCCAGTACCACAAGGCACACCTACAC
FL9213 9213 9232 TGTAAAACGACGGCCAGTCACCAATCACATGCCTATCA
FL9484 9484 9503 TGTAAAACGACGGCCAGTTCTTCGCAGGATTTTTCTGA
FL9747 9747 9766 TGTAAAACGACGGCCAGTTACTTCGAGTCTCCCTTCAC
FL10028 10028 10047 TGTAAAACGACGGCCAGTAACTAGTTTTGACAACATTC
FL10297 10297 10316 TGTAAAACGACGGCCAGTAAACAACTAACCTGCCACTA
FL10616 10616 10635 TGTAAAACGACGGCCAGTCAACACCCACTCCCTCTTAG
FL10910 10910 10929 TGTAAAACGACGGCCAGTAGCTGTTCCCCAACCTTTTC
FL11183 11183 11202 TGTAAAACGACGGCCAGTCGCCTGAACGCAGGCACATA
FL11467 11467 11486 TGTAAAACGACGGCCAGTAAAACTAGGCGGCTATGGTA
FL11766 11766 11785 TGTAAAACGACGGCCAGTGCACTCACAGTCGCATCATA
FL12057 12057 12076 TGTAAAACGACGGCCAGTAAAACACCCTCATGTTCATA
FL12357 12357 12376 TGTAAAACGACGGCCAGTAACCACCCTAACCCTGACTT
FL12600 12600 12619 TGTAAAACGACGGCCAGTATTCATCCCTGTAGCATTGT
FL12889 12889 12908 TGTAAAACGACGGCCAGTGCCTTAGCATGATTTATCCT
FL13188 13188 13207 TGTAAAACGACGGCCAGTCACTCTGTTCGCAGCAGTCT
FL13479 13479 13498 TGTAAAACGACGGCCAGTAGGAATACCTTTCCTCACAG
FL13721 13721 13740 TGTAAAACGACGGCCAGTTATTCGCAGGATTTCTCATT
FL13986 13986 14005 TGTAAAACGACGGCCAGTACTCCTCCTAGACCTAACCT
FL14279 14279 14298 TGTAAAACGACGGCCAGTGACCCCTCTCCTTCATAAAT
FL14559 14559 14578 TGTAAAACGACGGCCAGTCGACCACACCGCTAACAATC
FL14837 14837 14856 TGTAAAACGACGGCCAGTTGAAACTTCGGCTCACTCCT
FL15126 15126 15145 TGTAAAACGACGGCCAGTCCTTCATAGGCTATGTCCTC
FL15405 15405 15424 TGTAAAACGACGGCCAGTTCCACCCTTACTACACAATC
FL15696 15696 15715 TGTAAAACGACGGCCAGTTTCGCCCACTAAGCCAATCA
FL15948 15948 15967 TGTAAAACGACGGCCAGTAGGACAAATCAGAGAAAAAG
FL16221 16221 16240 TGTAAAACGACGGCCAGTCCCTCAACTATCACACATCA
FL16504 16504 16523 TGTAAAACGACGGCCAGTGTTCCTACTTCAGGGTCATA

@