TECHNICAL ANNEX

Table 4. H primers for amplification of heavy-strand of mitochondrial DNA

Primer Position Sequence (5'-3')
From to
H81 81 100 CAGCGTCTCGCAATGCTATC
H342 342 361 TTTTTGGGGTTTGGCAGAGA
H581 581 600 TTTGAGGAGGTAAGCTACAT
H609 609 628 GCCCGTCTAAACATTTTCAG
H742 742 761 TTGATGCTTGTTCCTTTTGA
H1014 1014 1033 AGCCACTTTCGTAGTCTATT
H1696 1696 1715 GGTTGTCTGGTAGTAAGGTG
H1591 1591 1610 TACACTCTGGTTCGTCCAAG
H1828 1828 1847 AGGTATAGGGGTTAGTCCTT
H2060 2060 2079 GGGGATTTAGAGGGTTCTGT
H2385 2385 2404 ACTTGTTGGTTGATTGTAGA
H2669 2669 2688 GGCAGGTCAATTTCACTGGT
H3082 3082 3101 TAGAAACCGACCTGGATTAC
H3538 3538 3557 AGAAGAGCGATGGTGAGAGC
H3876 3876 3895 GGGTTCGGTTGGTCTCTGCT
H4222 4222 4241 GAGATTGTAATGGGTATGGA
H4552 4552 4571 TTCTAGGCCTACTCAGGTAA
H4854 4854 4873 TTTTGTCATGTGAGAAGAAG
H5528 5528 5547 TTGAAGGCTCTTGGTCTGTA
H5759 5759 5778 TCAAACCTGCCGGGGCTTCT
H6009 6009 6028 CCCAGCTCGGCTCGAATAAG
H6158 6158 6177 TATCGGGGGCACCGATTATT
H6454 6454 6473 GATTAGGACGGATCAGACGA
H6757 6757 6776 ATGGTGTGCTCACACGATAA
H7005 7005 7024 ACAACGTAGTACGTGTCGTG
H7613 7613 7632 ATAGGGGAAGTAGCGTCTTG
H7758 7758 7777 GACGGTTTCTATTTCCTGAG
H8144 8144 8163 TAGTATACCCCCGGTCGTGT
H8395 8395 8414 GTATGGGGGTAATTATGGTG
H9133 9133 9152 ATTAAGGCGACAGCGATTTC
H9235 9235 9254 TCATGGGCTGGGTTTTACTA
H9483 9483 9502 CAGAAAAATCCTGCGAAGAA
H10137 10137 10156 TTTTCTATGTAGCCGTTGAG
H10629 10629 10648 GGCACAATATTGGCTAAGAG
H10913 10913 10932 GAGGAAAAGGTTGGGGAACA
H11179 11179 11198 TGCCTGCGTTCAGGCGTTCT
H11519 11519 11538 GGGTAGGCTATGTGTTTTGT
H11571 11571 11590 TAGGCAGATGGAGCTTGTTA
H11791 11791 11810 GAGTTTGAAGTCCTTGAGAG
H12000 12000 12019 GGTGAGTGAGCCCCATTGTG
H12451 12451 12470 ATAAAGGTGGATGCGACAAT
H12818 12818 12837 TGCTGTGTTGGCATCTGCTC
H12921 12921 12940 CTATTTGTTGTGGGTCTCAT
H13492 13492 13511 TTGGAGTAGAAACCTGTGAG
H13767 13767 13786 GGGGGATTGTTGTTTGGAAG
H14102 14102 14121 GAGTGGGAAGAAGAAAGAGA
H14321 14321 14340 GTGGTGGTTGTGGTAAACTT
H14378 14378 14397 TTAGTGGGGTTAGCGATGGA
H14754 14754 14773 GGGGTTAATTTTGCGTATTG
H14909 14909 14928 GTTGAGGCGTCTGGTGAGTA
H15162 15162 15181 TACTGTGGCCCCTCAGAATG
H15340 15340 15359 ATCCCGTTTCGTGCAAGAAT
H15755 15755 15774 ACTGGTTGTCCTCCGATTCA
H16016 16016 16035 CCCATGAAAGAACAGAGAAT

@