TECHNICAL ANNEX

Table 3. L primers for amplification of light-strand of mitochondrial DNA

Primer Position Sequence (5' to 3')
From To
L77 77 96 ACGCGATAGCATTGCGAGAC
L2815 2815 2834 GGGCGACCTCGGAGCAGAAC
L5545 5545 5564 ACAGCTAAGGACTGCAAAAC
L8281 8281 8300 CCCCCTCTAGAGCCCACTGT
L10796 10796 10815 CCACTGACATGACTTTCCAA
L13901 13901 13920 TCTCCAACATACTCGGATTC